Week 3- Analogy and Homology

Homologous Traits: Dogs and Humans

Has anybody ever come up to you and said that you share some similarities to your pet dog? I haven't either. It may seem absurd, but dogs and humans share more similar bone structures then you think. This bone structure, came from one common ancestor. Lets take a look at this pairing!

A. Dogs and humans within their anatomy possess a radial bone and ulna bone. Humans and dogs are both mammals, yet act vastly different in behavioral terms. Dogs or, 'canis lupis familiaris' are said to be closely to the wolf, 'canis lupis,' and the coyote, 'canis latrans. On the other hand, humans or, 'homo sapiens,' are said to be once closely intertwined with apes or, 'hominoidea.'

B. From the great contrast, you may be wondering how dogs and humans could possibly share similar bone structure. In humans, the radial and ulna bones are the two largest bones within the forearm. The radial bone extends from the laternal side of the elbow to the thumb side of the wrist and stands parallel to the Ulna. The Ulna joins with the humerous on the larger end to make the elbow joint, and joins with the carpal bones of the hand at the smaller end. The site, Healthline states the functioning as follows, "Together with the raidus the ulna enables the wrist joint to rotate." Conversely, Bluepearl a vet site explains the functions and location of these bones within canines, "The forelimb has two bones between the wrist, or carpus, and the elbow join, the radius and ulna. The radius is the main weight-supporting bone of the forelimb; whereas, the ulna supports only 20% of the weight." While the two structures seem greatly similar, they each provide different utilization for both species. Firstly, it must be noted that the ulna and radius within the human are located in the forearm, while these bones in dogs are located in the foreleg. Animals who possess arms use them in order to prefer different functions such as using the these bones to aide in rotating the wrist, in order to grasp objects or food easier. To add, human wrists also have more access to flexibility then the paws of a dog do since the structure starts to differentiate in the surrounding bones. Dogs use these bones in their forelimbs for walking and running. Dogs cannot pick up objects like humans, neither do they run similarly to humans.

C. So, how where does this structure come from and how could these two differing species share a common ancestor? I wondered this too as I was studying this subject. The answer lies in the what scientists believe was the first placental mammal, according to an article on National Geographic. The placentals include all living mammals except marsupials and monotremes. 

If this mammal possessed the radius and ulna human and dogs shared, it would likely appear in the foreleg in a much smaller and weaker form. 

Analogous Traits: Bees and Ducks

Like above, you might be wondering how two species that seem vastly different could possibly share something in common. Ducks and bees may be derived from vastly different organism, but that doesn't mean they don't share a body part without a common function. 

A. Bees or, 'Anthophila' originate from the 'insecta' family. On the other hand, ducks or, 'Anas platyrhynchos,' come from the, 'Aves' family. Both species provide different services within the food chain and environment. However, their wings provide the function of flight.

B. HowStuffWorks explains that bee wings are made up of, "Movable plates of Chitin." Chitin is commonly found in the exoskeletons of insects and is a fibrous substance consisting of polysaccharides. Ducks do not possess an exoskeleton like bees do. Their structure actually possesses an ulna and radial bone within the wing that aide them in flying. Though, these bones are much lighter in weight and size compared to how they're found in humans and dogs. These structures differentiate in order to compensate for the weight and anatomical structure of the animal. Chitin is an easily breakable substance in comparison to the solidity of the duck wing. The bee only needs its wings built like this because its' body is much smaller then that of the duck's. 

C. The common ancestor of these two beings likely was derived from an organism that probably had a significant lesser amount of shells. By looking through images that display, 'the tree of life,' I was able to draw that the the common ancestor likely did not have the wings or any form of flight. These traits are not genetically related because insects possess an exoskeleton that ducks do not have in any shape or form. 

Works Cited

Yong, Ed. “Meet the Ancestor of Every Human, Bat, Cat, Whale and Mouse.” Phenomena, National Geographic | Phenomena, 7 Feb. 2013, phenomena.nationalgeographic.com/2013/02/07/meet-the-ancestor-of-every-human-bat-cat-whale-and-mouse/.

“Radius and Ulna Fractures in Dogs and Cats | BluePearl Vet.” Blue Pearl Specialty and Emergency Pet Hospital, 11 July 2016, bluepearlvet.com/medical-articles/fractures-of-the-radius-and-ulna/.

“Ulna Bone Anatomy, Diagram & Function | Body Maps.” Healthline, Healthline Media, www.healthline.com/human-body-maps/ulna-bone.

Wilson, Tracy V. “How Bees Work.” HowStuffWorks, HowStuffWorks, 30 May 2007, animals.howstuffworks.com/insects/bee1.htm.

Week 2- Protein Synthesis Coding Fun!

Here is my DNA Strand:

TAGATACAAATTGTCTCACGCAAGCCCCAGTTTAATCGCTA

Charles Darwin and Jean-Baptiste Lamarck

Charles Darwin and Jean-Baptiste Lamarck's Influence

1. Unlike most individuals during their time, Darwin and Baptiste both thought life gradually developed over time, continuously. That organisms fit and change to adapt to the environment they live within. Charles Darwin and Jean-Baptiste both held positive influences over one another, due to developing scientific theories that surrounded the subject of natural selection.
2. Lamarck was born August 1st, 1744 in France. He was the youngest sibling out of eleven children within his family. Lamark was one of the first in attempting to formulate an expanse of the animal kingdom. With this, he was also the first to coin the term, 'invertebrate.' Additionally, in the year of 1802, he invented the term, 'biology.' 
3. Lamarck is best known for his Theory of Inheritance of Acquired Characteristics, which was first presented in 1801. The basis of this theory stated, if an organism changes during life in order to adapt to its environment, those changes are passed on to its offspring. Furthermore, change is made by what the organisms want or need (Burkhardt). Similarly, Darwin believed that if the environment changes, the traits that are helpful or adaptive to that environment will be different. Likewise, Darwin believed that organisms with traits that were better adapted to their environment would have greater reproductive success because those traits allowed them to be more competitive for the things they needed to reproduce. All in all, both scientists believed the environment made great impacts on the way a species' evolved. Darwin took Lamarck's ideas about the environment, and incorporated them within his own work in order to help formulate the evolutionary theory. 
4. Without Lamark's theories, Darwin may have struggled in forming his own theories. The environment plays a heavy complex role within evolution and adaptation. Moreover, Lamark also provided Darwin of a skeleton of the animal kingdom. Despite its inaccuracy, it aided and furthered Darwin's work. Ideas and theories never turn out accurate when first studied, as they start out as mere a mere hypothesis. Without a rough basis, an idea may never progress.
5. At first, Darwin was hesitant to make his theories public due to the church's contrasting creationist beliefs. His religious wife, also feared the backlash her husband's theories may come with ("Charles Darwin's Faith and Religious Beliefs"). Nevertheless, he published his book, On the Origin of Species in 1859. The church attacked the book with hostility, and the series of debates that followed attempted to distort Darwin's theory of evolution including the beliefs that followed.

Works Cited

Burkhardt, Richard W. “Jean-Baptiste Lamarck.” Encyclopædia Britannica, Encyclopædia Britannica, Inc., 5 May 2014, www.britannica.com/biography/Jean-Baptiste-Lamarck

“Charles Darwin's Faith and Religious Beliefs.” Charles Darwin's Faith and Religious Beliefs, www.age-of-the-sage.org/philosophy/charles_darwins_faith_religious_beliefs.html.