Week 8- Human Variation

Solar Radiation and Human Adaptation

1.  The environmental stress I'm choosing to focus on, specifically will be high levels of solar radiation. In tropical latitudes, especially in non-forested regions, ultraviolet radiation from the sun is immensely present. These high levels of solar radiation may cause sunburn damage, harmful DNA changes, and several types of dangerous skin cancers. One of these malignant cancers, is known as Melanoma. Approximately 8,000 individuals from the United States have passed away from this cancer. Furthermore, individuals who tend to have a lighter skin tone are at a higher risk of getting cancer within their lives because of their lack of protection against the sun's ultraviolet rays. This disturbs homeostasis within humans because the sun serves as an environmental challenge that caused a variation within the skin pigments of humans.

2.  There are four ways human individuals have learned to adapt from the high radiation the sun produces. Firstly, short-adaptation allows an organism to rapidly respond to changes within their environment in order to maintain homeostasis. This type of change does not involve genetics within the individual. The response is generally a quick one and once the stress is removed, the organism will return to its original state. In response to high levels of radiation, humans are known to receive what is called a sunburn. This is when the skin flushes red, turns itchy, or sometimes very painful depending on how badly an individual is exposed to the ultraviolet rays the sun produces. Depending on the severity of the burn, sun burns can generally last one to four days. As long as the stress is removed and treated, the burn heals within the long run.

Next, we have the term known as facultative adaption. Facultative adaption involves genetic traits. They do not require a change within the organism's DNA but they do involve turning on and off to alter a phenotypic expression in response to an environmental stress. The falcutative adaption in response to high radiation from the sun would be the skin becoming tanner. Above, sun burns are mentioned as a short-adaption. After sun burns heal, the skin typically becomes tanner in response to better aide and protect the human individual in the future against the sun's UV rays.

Third, there is also developmental adaptions in response to the sun's radiation. Developmental adaptions are actual changes in the DNA of a population of individuals in response to a long-term stress to produce a phenotypic change through evolutionary forces. An example of this would be the actual variation in skin color we can visibly see in human individuals. For example, if we were to take an individual who was of lighter pigment and move them to a continent or other landmass that experiences great heat and sun radiation, the generations that follow the lighter pigmentation individual will gradually grow darker in skin tone. Conversely, an individual who does not see much sun could turn lighter in pigmentation as the generations pass on. This trait is controlled by red cells in blood flowing close to the skin.

Finally, there are cultural adaptations. Humans are relatively unique in their use of culture to help them adapt to given environmental stresses. A significant example of this would be the invention of sunblock within society. Sun block is a cream or lotion individuals apply to their skin in order to protect them from the ultra violet rays of the sun. Many cultures apply this to their skin now in order to lessen the chances of receiving a sun burn. Additionally, some individuals may use umbrellas in order to aide in shielding their faces and skin from the sun when they're outside.

3. There are various benefits to studying human variation from this perspective across environmental clines. For one, it can benefit within our society by helping us discover we are all humans regardless of skin color, and the pigmentation we each possess aides in understanding how throughout millions of years we've grown more diverse. Furthermore, the ideology of human 'races' has developed from the variation in human skin pigmentation. From learning about where these pigmentation come from, we learn how the environment and evolution played a heavy role in producing all the variations within the human race. From skin pigmentation, we can also understand and piece together what the climate is like, depending on where the human individual came from. For instance, if we took someone from Ireland whose a lighter skin tone, we can infer that Ireland must not receive sun as much as other areas do.

4. As mentioned above, understanding human variation through adaption instead of race is able to be utilized to our advantage in a variety of positive ways. Humans are diverse in pigmentation that occurred due to the environments that surround us. We are all apart of the same species, and that is being human. We may look different and more diverse from one another, but that is because the environment has come to impact us and the appearance we may possess. Generally, the closer individuals are to the equator, the darker skin tone they may show and reflect. The physical environment does not affect personality or change the fact that we are human. Studying this subject specifically, overall can help us come to terms with how truly connected we are to one another.

Week 7- Language Blog

Part 1: Symbolic Language

1. For this assignment, I used my younger sister as my conversation partner. We both thought this first part of the experiment was significantly challenging within the first few minutes. Within the first few minutes, she was the only individual who could carry the conversation since I had the inability to speak, but instead could respond with grunts, pitch raises, expressions, and body language. At first, there were gaps of silence within the conversation before a notable shift had taken place while my partner tried to figure out how to phrase her wording. From my observation, the conversation took a more simplistic turn as I was being asked mainly, 'yes' or 'no' questions. Some of these questions including: Was your day good or bad? How are you feeling? Or, my partner would instruct me to give a certain gesture if I agreed or disagreed with something that she had stated. Within about eight minutes, the conversation started to flow a bit more due to the adjustments that were made. My partner was able to understand how I felt by reading my expressions and paying attention to the gestures I made in response to her questions.

2. Within this part of the experiment, while I attempted to be in more control of the conversation, my partner had a much better handle on it. This lead to my partner initiating most of the topics, along with changing the subject when my gestures or expressions became incomprehensible. As I mentioned above, most of the questions were made up of simply, 'yes' or 'no.' Along with this, she asked how I felt about certain subjects by asking I held up my fingers to sign a number, "On a scale of one to ten." Because I conducted this experiment with only one individual, I was unable to report on whether I was excluded or not. However, from my observations with the gaps of silence within the beginning, I predict it being a very likely possibility. Utilizing words draws the attention of other individuals since they're able to directly comprehend what you're trying to communicate with them. With all this information gathered, I can conclude that my partner had the most power within this conversation with her ability to speak and ask questions.

3. With what I'm able to gather from how the conversation shifted tones with me being unable to speak, I believe the speaking culture has the greater ability of communicating complex ideas within their population. This is because they are able to go in depth and in detail with the language they have created and speak while a population who lacks this ability, will end up more simplistic within the long run. From observation, I believe the culture whose able to communicate would view themselves to be more above then the individuals who lack the ability to speak as they do. This is because the culture who possesses the ability to speak, may perform more complex tasks and possesses the emotional capability of understanding the other person more. There are a few mirrors of these ideology within modern society today. For one, their is the relationship between humans and their pets. Pets are not able to communicate with words, but their body language or the sounds they make can get the message across to what they may want or don't want. Furthermore, we are not able to hold complex conversations between them. To add, many humans also view themselves to be more complex and above the thought processes of animals since they are not able to hold complex conversations between one another. Furthermore, there is also the possibility of a foreigner coming into another country and lacking the ability to speak that country's native tongue. Because of this, certain individuals may lead to be confused or even dismissive of this individual because they are not able to comprehend them like they are able to with the other's who speak in their own language.

Part 2: Speaking Without Expression

1. Within this part of the experiment, it was indeed easier to bring more complex ideology within the conversation. However, it was hard for my partner to comprehend how I felt about those ideas, because of her inability to read my body language, tone of voice, or recognize gestures. Despite this, I thought this was easier then the first part of the experiment, because I was at least able to speak and hold the conversation better. Though, my partner did end up struggling trying to figure out if I was asking questions or saying a general statement due to my inability to alter my tone of voice. I also observed her eyes wandering my expression as if she was trying to still figure out how I felt about certain questions she asked me.

2. After this experiment, I further realized how important non-speech gestures, expressions, and voice tones were when applied to a conversation. Expression allows us to understand and communicate better with what the individual may be feeling, especially emotionally. Words, especially when they carry emotion are significant when it comes to what's comprehended within the conversation. Without emotion or expression, is significantly challenging to determine how the individual feels about what their partner in the conversation is saying as well.

3. Being perceptive to body language is useful for surviving, obtaining resources, and reproduction for a variety of reasons. Survival wide, reading body language is significant for an individual being able to perceive and pick up on possible threats. These threats could come in a variety of ways. If someone raises their voice, the flight or fight response is triggered as a natural response to possible danger. Additionally, communicating possible threats to other individuals is useful for survival. It would be hard to distinguish what is a threat and what is not if humans only spoke in a monotone voice. Communication is also useful for obtaining resources, since we are able to communicate where those resources possibly are and if they are usable or not usable. Expression is especially important for reproduction. When humans feel comfortable with one another, they often are generally relaxed, calm, and respond in positive mannerisms. These emotions are visible through our sense of expression. Without body language especially, reproduction would be significantly more challenging.

4.  Sometimes, because young children's brains are still developing, they are unable to comprehend certain expressions fully. They may pick up on the basic ones, but certain aspects such as sarcastic comments or knowing the difference from a sincere comment or insincere one. If the child continues like this, they may develop a learning disorder, or have trouble comprehending social cues within the future. Individuals who also possess certain disorders may have trouble picking up on social cues, such as social-emotional agnosia. On the other hand, body language does not solve everything. Basic necessities such as eating or drinking are still possible. Individuals who are known to be good liars may also be aware of how to correct their body postures or expressions when not telling the truth, which may send up false flags to the individual they are lying too. Additionally, body language can always be misinterpreted and not one hundred percent accurate to how the person chooses to perceive it.

Week 5- The Piltdown Hoax

The Piltdown Hoax

1. During the year of 1912, at Barkham Manor near the village of Piltdown in England, a laborer encountered a strange piece of human-like skull bone. This laborer then was said to have reported this to Charles Dawson, and amateur archaeologist. Dawson noted the skull appeared thick and rather primitive.

Back within the 1800s, Charles Darwin's most controversial claims was his belief that apes and human individuals were related. Though, Darwin unearthed fairly little evidence to back up his claims when it came to finding specific evolutionary branches that led to this theory. Thus, the discovery at Piltdown would make a significant difference in unearthing more evolutionary evidence. Dawson and Smith Woodward commenced working together, proceeding to make further discoveries within the area. They found a set of teeth, a jawbone, more skull fragments, and primitive tools which they thought belonged to the same individual. Later, Woodward reconstructed these skull fragments, and the archaeologist developed a hypothesis that this human ancestor lived about 500,000 years ago. Afterwards, they announced their discovery at a Geological Society meeting in 1912, with the majority of scientist accepting this claim as fact. The discovery was so huge, that it made world news across various continents including America, Europe, and even Africa. Despite the huge news the Pildown discovery had made, some scientists still wondered if the oddly matched jawbone and skull were truly from the same creature. During the time, scientists remained doubtful of the discovery, but because the articulation on a certain part of the jaw was broken off, there was no way to truly falsify or prove the jawbone fit the skull at the time. The crucial piece that was absent within the articulation, was the canine tooth. However, a year later, a canine tooth that more or less fit the skull was found at the Piltdown site that seemingly silenced the doubters. Additionally, in the year 1917 Woodward was said to have found another skull and tooth within the same site in Piltdown.

Unfortunately, in 1953 an announcement was officially made that the Piltdown Man was found to be a fake. This concluded, that the Pildown discoveries had been a hoax. In the year 1949, new dating technology came about that changed scientific opinion pertaining to the age of the remains. Utilizing fluorine tests, Dr. Kenneth Oakely, a geologist at the Natural History museum uncovered that the remains found within Piltdown were only 50,000 years old. This eliminated the possible accuracy of the remains discoveries because by this year, humans had already developed into their Homo sapien form. This unfortunate discovery triggered an uproar within the scientific community. This embarrassment was even brought up within the British parliament, and led further to mixed reactions. Individuals started to question how scientist could have been fooled by something such as this for as long as they had. The public truly started to question the authenticity of the scientific community, following this change. Follwing this, biological anthropologist Dr. Joseph Weiner and human anatomist Wilfrid Le Gros Clark, worked with Dr. Oakley to further test the age of the Piltdown findings. They found that the jaw was not a human one at all, it was in fact, possibly an orangutan's. The teeth on the jaw had been filed flat to disguise them while the fossils had been boiled and stained with chemicals in order to give them an aged look.

2. Of course, many of the mistakes which occurred during the Piltdown hoax were human-made errors in judgement. Being human, individuals are inclined to make mistakes when they believe to have found new discoveries that peek their curiosity. Naturally, Dawson and Woodward jumped to many conclusions in their impulsiveness instead of utilizing more logical approaches in their methods. The impulsiveness made them eager to put out their findings quickly, rather then recognizing the technology they possessed may possess loopholes when trying to determine the age of the skull pieces. One noticeable mistake, was their swiftness in putting out the findings before they found a canine tooth that would 'supposedly' fit the jawbone. Impulsive behavior and jumping to conclusions in science proves to make various negative impacts. Impulsiveness may lead scientists in wanting to put out their findings as fast as possible without further research into their hypothesis. If impulsiveness happens upon every discovery made, the public's trust may start to decline in certain ways as more possible doubts arise. From the Pildown hoax, scientists should remember to study their findings thoroughly by backing it up with evidence and verifiable sources before publishing their conclusions. 

3. Despite the negative human errors, there is still some positive aspects to be found within the Piltdown hoax event. Skepticism is a scientists' friend for many reasons. For one, if there were no doubters surrounding these findings, ignorance could have arisen within the scientific community. Without the skepticism, the world might still believe the findings within Piltdown to be true. Textbooks pertaining to Anthropology may have even mentioned the supposed, 'species' of primate found within Piltdown. The willingness to question findings by conducting tests proved to be positive in this case. Because of the new technology that was able to use chemical fluoride in order to better provide accurate results, scientists were able to falsify the findings of Piltdown. It is always significant to pose questions, if these scientists continued to rely on old technology as accurate for the Piltdown findings, the 'hoax' would have never been falsified. As mentioned above, the flouride tests were able to prove the fossils were only 50,000 years old rather then the previous belief which was 500,000. The key scientific processes used in all this specifically were asking questions, conducting further background research, and further experimentation under a hypothesis.

4. Despite how many individuals may want to eliminate human error, it is almost impossible to eliminate such errors entirely. As the saying goes, "We are humans, and bound to make mistakes." Nobody is going to be flawless in their first scientific claims to begin with. The individuals that came before Darwin are few of the many examples of this. Their discoveries were not accurate at first, yet Darwin was able to take their pieces of information in order to form his own theory. However, as mentioned above scientists have learned from the hoax, and by continuing to remain as skeptics and utilizing logic in their claims, mistakes from impulsiveness are immensely reduced. When it comes down to it, no, I would not remove the human factor from science. If the human aspects were removed completely, there would cease to be any aspect to learn from in the first place. The human lesson learned from the hoax overall, was scientists learning to better verify the accuracy of their sources before publishing their conclusions.

5. The life lesson people can take away from this, would be to always remain skeptical until you have hard evidence found within a verifiable source. Individuals should be cautious of being impulsive within their discoveries, and should try to be cautious by being self-aware of their impulsive nature. Additionally, scientists should always keep in question the reliability of the technology available to them before finalizing their results entirely. By jumping to conclusions without verifiable evidence, more hoaxes are bound to take place. 

Week 3- Analogy and Homology

Homologous Traits: Dogs and Humans

Has anybody ever come up to you and said that you share some similarities to your pet dog? I haven't either. It may seem absurd, but dogs and humans share more similar bone structures then you think. This bone structure, came from one common ancestor. Lets take a look at this pairing!

A. Dogs and humans within their anatomy possess a radial bone and ulna bone. Humans and dogs are both mammals, yet act vastly different in behavioral terms. Dogs or, 'canis lupis familiaris' are said to be closely to the wolf, 'canis lupis,' and the coyote, 'canis latrans. On the other hand, humans or, 'homo sapiens,' are said to be once closely intertwined with apes or, 'hominoidea.'

B. From the great contrast, you may be wondering how dogs and humans could possibly share similar bone structure. In humans, the radial and ulna bones are the two largest bones within the forearm. The radial bone extends from the laternal side of the elbow to the thumb side of the wrist and stands parallel to the Ulna. The Ulna joins with the humerous on the larger end to make the elbow joint, and joins with the carpal bones of the hand at the smaller end. The site, Healthline states the functioning as follows, "Together with the raidus the ulna enables the wrist joint to rotate." Conversely, Bluepearl a vet site explains the functions and location of these bones within canines, "The forelimb has two bones between the wrist, or carpus, and the elbow join, the radius and ulna. The radius is the main weight-supporting bone of the forelimb; whereas, the ulna supports only 20% of the weight." While the two structures seem greatly similar, they each provide different utilization for both species. Firstly, it must be noted that the ulna and radius within the human are located in the forearm, while these bones in dogs are located in the foreleg. Animals who possess arms use them in order to prefer different functions such as using the these bones to aide in rotating the wrist, in order to grasp objects or food easier. To add, human wrists also have more access to flexibility then the paws of a dog do since the structure starts to differentiate in the surrounding bones. Dogs use these bones in their forelimbs for walking and running. Dogs cannot pick up objects like humans, neither do they run similarly to humans.

C. So, how where does this structure come from and how could these two differing species share a common ancestor? I wondered this too as I was studying this subject. The answer lies in the what scientists believe was the first placental mammal, according to an article on National Geographic. The placentals include all living mammals except marsupials and monotremes. 

If this mammal possessed the radius and ulna human and dogs shared, it would likely appear in the foreleg in a much smaller and weaker form. 

Analogous Traits: Bees and Ducks

Like above, you might be wondering how two species that seem vastly different could possibly share something in common. Ducks and bees may be derived from vastly different organism, but that doesn't mean they don't share a body part without a common function. 

A. Bees or, 'Anthophila' originate from the 'insecta' family. On the other hand, ducks or, 'Anas platyrhynchos,' come from the, 'Aves' family. Both species provide different services within the food chain and environment. However, their wings provide the function of flight.

B. HowStuffWorks explains that bee wings are made up of, "Movable plates of Chitin." Chitin is commonly found in the exoskeletons of insects and is a fibrous substance consisting of polysaccharides. Ducks do not possess an exoskeleton like bees do. Their structure actually possesses an ulna and radial bone within the wing that aide them in flying. Though, these bones are much lighter in weight and size compared to how they're found in humans and dogs. These structures differentiate in order to compensate for the weight and anatomical structure of the animal. Chitin is an easily breakable substance in comparison to the solidity of the duck wing. The bee only needs its wings built like this because its' body is much smaller then that of the duck's. 

C. The common ancestor of these two beings likely was derived from an organism that probably had a significant lesser amount of shells. By looking through images that display, 'the tree of life,' I was able to draw that the the common ancestor likely did not have the wings or any form of flight. These traits are not genetically related because insects possess an exoskeleton that ducks do not have in any shape or form. 

Works Cited

Yong, Ed. “Meet the Ancestor of Every Human, Bat, Cat, Whale and Mouse.” Phenomena, National Geographic | Phenomena, 7 Feb. 2013, phenomena.nationalgeographic.com/2013/02/07/meet-the-ancestor-of-every-human-bat-cat-whale-and-mouse/.

“Radius and Ulna Fractures in Dogs and Cats | BluePearl Vet.” Blue Pearl Specialty and Emergency Pet Hospital, 11 July 2016, bluepearlvet.com/medical-articles/fractures-of-the-radius-and-ulna/.

“Ulna Bone Anatomy, Diagram & Function | Body Maps.” Healthline, Healthline Media, www.healthline.com/human-body-maps/ulna-bone.

Wilson, Tracy V. “How Bees Work.” HowStuffWorks, HowStuffWorks, 30 May 2007, animals.howstuffworks.com/insects/bee1.htm.

Week 2- Protein Synthesis Coding Fun!

Here is my DNA Strand:

TAGATACAAATTGTCTCACGCAAGCCCCAGTTTAATCGCTA

Charles Darwin and Jean-Baptiste Lamarck

Charles Darwin and Jean-Baptiste Lamarck's Influence

1. Unlike most individuals during their time, Darwin and Baptiste both thought life gradually developed over time, continuously. That organisms fit and change to adapt to the environment they live within. Charles Darwin and Jean-Baptiste both held positive influences over one another, due to developing scientific theories that surrounded the subject of natural selection.
2. Lamarck was born August 1st, 1744 in France. He was the youngest sibling out of eleven children within his family. Lamark was one of the first in attempting to formulate an expanse of the animal kingdom. With this, he was also the first to coin the term, 'invertebrate.' Additionally, in the year of 1802, he invented the term, 'biology.' 
3. Lamarck is best known for his Theory of Inheritance of Acquired Characteristics, which was first presented in 1801. The basis of this theory stated, if an organism changes during life in order to adapt to its environment, those changes are passed on to its offspring. Furthermore, change is made by what the organisms want or need (Burkhardt). Similarly, Darwin believed that if the environment changes, the traits that are helpful or adaptive to that environment will be different. Likewise, Darwin believed that organisms with traits that were better adapted to their environment would have greater reproductive success because those traits allowed them to be more competitive for the things they needed to reproduce. All in all, both scientists believed the environment made great impacts on the way a species' evolved. Darwin took Lamarck's ideas about the environment, and incorporated them within his own work in order to help formulate the evolutionary theory. 
4. Without Lamark's theories, Darwin may have struggled in forming his own theories. The environment plays a heavy complex role within evolution and adaptation. Moreover, Lamark also provided Darwin of a skeleton of the animal kingdom. Despite its inaccuracy, it aided and furthered Darwin's work. Ideas and theories never turn out accurate when first studied, as they start out as mere a mere hypothesis. Without a rough basis, an idea may never progress.
5. At first, Darwin was hesitant to make his theories public due to the church's contrasting creationist beliefs. His religious wife, also feared the backlash her husband's theories may come with ("Charles Darwin's Faith and Religious Beliefs"). Nevertheless, he published his book, On the Origin of Species in 1859. The church attacked the book with hostility, and the series of debates that followed attempted to distort Darwin's theory of evolution including the beliefs that followed.

Works Cited

Burkhardt, Richard W. “Jean-Baptiste Lamarck.” Encyclopædia Britannica, Encyclopædia Britannica, Inc., 5 May 2014, www.britannica.com/biography/Jean-Baptiste-Lamarck

“Charles Darwin's Faith and Religious Beliefs.” Charles Darwin's Faith and Religious Beliefs, www.age-of-the-sage.org/philosophy/charles_darwins_faith_religious_beliefs.html.